Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098H11
Clone ID P098H11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P098H11
Sequence
TCATACTACAAAAAAAACCCCTCCNNCAANNCCCAANNNNCAAACAACCACAANNCACCCTAACACACCCCCCCAACCAC
CCACACTCCAGTACCACCAGAAAATTGACCCAGCACATCCACATAAATTACCTTTTGACAGAGCTGTGGTCATGGCAGCA
TGGTAGGATCCGTGTCCCGGACCCTGAGGCCAGAATGAGTGAAGAAGCATGCCGAACCCGCAGTCAGAAGCGCNNNCTTG
NNNCTGNNNTAACGGAGGATGATGTGGAGAACAAGAAAATGAAAATGGAGAAAGGGTCATCAGAGCTGACAGTGGACGGA
GACAGCAGGGTGATGCCAGAGCCGAGTGCAGGCTCAGCCCAGGGGTTGCTGAGGACAACAGAGGCCATGGGCACAGGATC
TGGCGAGGGGCTGTTAGGAGACGGGCCTGTGGACATGCGCACTTCACACAG
Sequence Type mRNA
Unitrap ID UNI3517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72459678..72474648 243
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


SPLK-Sequence tag 5SP098H11
Sequence
GATCTGCACTGTGACTTCCACCTAACTTTATCCTGTGTCACAGTGCCATCTAGTGGACATATTCTGAGCTGCTTTCCACA
AGCAAGTTGGTACTTGCTTGGGTGCTGGGATACACACCAAGGGGCAGTTTAGGTTGTCCACTGTGAGCAGTACTTTTTCT
AGGACTTGGTGCTCCTCCCACCTCCTTCCTGTGTTACAGCAACAGAGCACACTGGCTTTAAGGATTTAGAAGCAACAGAT
GTGTATGCCCTCTGATACCCTTCACAAAGAGGGAGGTCTAATTTTGGGGTGCTCCTGTGTGGGTTAACTGATGTAGGCTA
Sequence Type genomic DNA
Unitrap ID UNI3517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72442776..72443095 314
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


SPLK-Sequence tag 3SP098H11
Sequence
GCCACTGGTCTNNCGCCAGTGTGGGAAGAGTGGTCAGTGTTGTGGACCTGTGCATCTGACAGTGTGTACCACCCCTGCTA
CAACTGAGCTCCTAGGGAGACTGGCTGTTTGCTCACAGGGAAAAGTGAACTTCCTACACCACAGGATGTGTGTTAGAAGG
TTGGTCACAGTGGTGAGTGTTCCATGATGTAACTTCTTCTGAGACTTGAGTGTGCAGGGTTGAGGGCAGAGCCATCACAC
TCTGTAGACCTGAGCATGAAGTCAGTGAGAGTGGTTCTTTTGAGTTTGAAAACTTGTAGCCACTGCAGCCACTTGTTATG
TGTGTCCTAGGTAGGACAATGCAGCAGATGGCCCCAGGTCCCCTTGTGAGGTAGAGAGCAAAAGCTAACAGTACATCATT
GTGCTTTTTGGTCTTCTGGGGGGCTGTATGGGACTGGGTTAAGAGAGGGGTGGGCTTCCCANNNNGTAGTTCCCAATGTG
AGACCTTGGCTTTGGAGTGCTCACGTCCATCCTACCCAGCACTCAGGAGCTGAGATAGCAGACCAAG
Sequence Type genomic DNA
Unitrap ID UNI3517

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72442225..72442768 521
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es