Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098H02
Clone ID P098H02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 3SP098H02
Sequence
ATCAAAGGTGTGCATGNNCCATAACTGTCCTGGTAAACTTTTTTGAATCATAGGAGAACTAGGAGAAAAAGAAATGTAAA
GAAATAAGCTGCAGTTATATTGTAGATGAATGTATTGAGAGAGGCTGCTTTTGTATAGCAGCCTAGACTTGATCATGGCC
TAAGATTTTGCTGGTTAAATACTCTTAGATATGGCCTTGATAAATCAGGTCAGTTTAAAGAATAGGTA
Sequence Type genomic DNA
Unitrap ID UNI369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44388008..44388235 224
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es