Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098G03
Clone ID P098G03
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P098G03
Sequence
TAACCTCCCACTCGGGCCCAGTTCGCATCCGAGGGCTCCGCCTGAGATTTTCGTGGGGCCAGCTNTCCCTGGGCTNGATC
CCACCCGNNCGGGTTGGCCAGCACATTGAGCCAGCACATCCACATAAGTTGCCTTTTGACAGAGCTGTGGCCATGGCAGC
ATGGTAGGANNNGTGTCCCGGACCCTGAGGCCAG
Sequence Type mRNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72474552..72474654 95
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


SPLK-Sequence tag 5SP098G03
Sequence
CCATATGCTGATGAGGCATGAATGGGGAAACTGAGCCTGCACTTGTCCTTTGCCCAGGATCATCTTTTTGACTCCTAAGT
TGAATTAGATTCTTTTACTTGGCTTCACTGAGGCAGTATTTAAAGGTTGAAACTTGGGCTTTCGAGTCTGAATTCTTCCA
GAAGAGTCCCCACCACTCTGACATTTGGATGTGTGGCAGGAAGTGGCTTGGGCCCACCCAGGCAAGTCTCAGTGTCTGTT
TTGGCTTGGAGAAAACCTGCC
Sequence Type genomic DNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72464458..72464718 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]


SPLK-Sequence tag 3SP098G03
Sequence
CCTCCCCAGCATTTTGGGACTTGGCTATAAGAGCCTGGCTGTGCTATGTGGTTAGAGCAGACATGGCTTCTGGGCTCCAG
TTGCTGATGGGGAATGACCTGGCCTCTATCTTGGAGGACAACTTTGTGGCGAGAACCTGCAGGAGCCGGGCAGCAGGGCC
TCCGTGCTGTATGGCTGGGCTCCATATCATCCTGGGGCAATGGCACCTTGGTATTGTCCTTCAGTTGTCCTGTCCTTGGG
CGGGCTGCTTCAGAAGGCCTGCTTTCTTCCAGACAGGAAGTGAGACAGGAAATGATGGCCCCTTAAAGCCCCAGGGCAGA
TGCTATCCTCAAGGAGTGGTCCACAGTTGCACCAAACTGTAGTCTTGACTTTTCCATCCCAGTTTCAGAAGAGTCTATTG
CTTGAGTAGAACCAAATAAAAGTAGAGCAGTCCCCCCTTCCCCCATCCATGCTTAGGGGAGCTTCAGAGCACACCTAGGA
GGGAAATCTGTTCCCACAGCACTGTCTCGTCCCTTAGTGCCCCACTACCTATCAGCCAGATACTGCTTTAGAGTGAGGTG
GACCTCTGGG
Sequence Type genomic DNA
Unitrap ID UNI471

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72463858..72464427 564
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036180 (Gatad2a) NM_145596 GATA zinc finger domain containing 2A Gene [Source:MGI Symbol;Acc:MGI:2384585]

 
Come back to gene ENSMUSG00000036180


For any suggestions or comments, please send an email to unitrap@crg.es