Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098E11
Clone ID P098E11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P098E11
Sequence
GGCCACCTCCCGACTGCTGGGACTCTGCTAGTCCTTCTGGGATCCGCTCGGAGGGGACCCAACGCCTAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP098E11
Sequence
GGCTGGATCTTGAGGGAAGAGTTTGGCTCTGGCTATCATTTGACCTTTGGACTGATGGAGAACCCATTTTGTT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SP098E11
Sequence
TTTGAGCACCTACTGTATGCTAACTTCTGGGAACGTGACAGTGAAGAAGAAGACACCGTCCTCAGAGCCTGAGAAAGAAT
TAGGTCAGGACATGGGTGGGGAAACTGAGTCAAAGCCCCATAAGCAGCAGTGGCAGAGGCCTATGTCCTTAGGCAAG
Sequence Type genomic DNA
Unitrap ID UNI10847

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 45181004..45181160 157
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000066705 (Fxyd6) NM_022004 FXYD domain-containing ion transport regulator 6 Gene [Source:MGI Symbol;Acc:MGI:1890226]

 
Come back to gene ENSMUSG00000066705


For any suggestions or comments, please send an email to unitrap@crg.es