Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098E10
Clone ID P098E10
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P098E10
Sequence
AAACANNAACAAGACAAAAACAAAAGGGGCGGGGGGCCAAAAGCNNGGACAACCGCCTTCGAAGCCGGGAGTGATCTCGG
AGGAAAACCTACACATGAANTTTCCCCATTAACCCCAAAATTAAGATGCCCCAGGAGGAGCTGCAGAAGCGGAGGAGGAG
GAATTCAACACAGNNCCCTCTCAATGCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAAC
AAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP098E10
Sequence
GCGGTGGGTGGAAGAGGTTAGGTAGATGAGCCAGAGCAGGCTACCATTGGAAATGTCTCTCCTGCCTCCAGTAAAGACTG
CACCAGAAAGGGGGCTGGGGAGACACTGGACAGTGTGGCTTTGATCACGTACATTTCCAACTTGAACCCATCTCACCCCT
GGGTTCTCTATCCAGGAGTCTCCTCAATAAACCCAAGAGTGAGATGACCCCAGAGGAGCTGCAGAAGCGGGAGGAGGAGG
AATTCAACACAGGTCCCCTCTCNNNTCTCACGCAGTCGGTCAAGAACAACACGCAAGTGCTCATTAACTGTCGCAACAAC
AAGAAGCTGCTGGGCCGGGTGAAGGCCTTTGACAGGTGAGTGCGGTCTTGGGGAGGGCTGGGTCTGGGTCTGAGGGGCCT
GAAGGAAAGGTCATTCCAGAAGGATAATAAGGTGGGCACACAC
Sequence Type genomic DNA
Unitrap ID UNI14190

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 19736393..19736834 421
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040824 (Snrpd2) NM_026943 small nuclear ribonucleoprotein D2 Gene [Source:MGI (curated);Acc:Snrpd2-001]

 
Come back to gene ENSMUSG00000040824


For any suggestions or comments, please send an email to unitrap@crg.es