Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P098B05
Clone ID P098B05
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP098B05
Sequence
TCTGTCTGTAGATGTTTCTTTTTGTTTGCTTTGTTCTGTTAGGGGTTTTCAGG
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52183934..52183986 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es