Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P097H11
Clone ID P097H11
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P097H11
Sequence
TTTCTCCGGGAAGTGTGCTTGCCGAGCTAAGAGCGGTCCTCTCACCTCGGCTGCGTGAGAGGCTGCGTGCCCCACAGGNN
NCGCGGCCCTAAGAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP097H11
Sequence
TCCTCGGCTCTTAAAGTCACAGCGCTCTAGCCCCAGCGGTGCTGCCTGCCTTTTCCCCTCAGTGTTCCTCCGAGTGCGGC
ATTACGGAGTAAGGGGAACAACGGAGGCCCCTCCTGAGACAGGTGTACGAGCTTCGGTCCCATCCCCAAGGAGGGGTAGC
TTTGGAAAACTGCTGGAGCCCCACGGCCTGCTTTGGGGAGGAGCCTTATCCTCTGGGACTTTGTTTTCCTTCCCCATAAT
GTGAACACCTAGTTTCTTGTCTGTGGCTTTTTTAGGGGCGCCCTGGGGAGATTTCAGTCTCTATTGTTANNNNAGGCTTA
GCCGAAACTAAAGGGGTTCTTTAACCAAGGTCACCCAGGGAGTCTAAGCTGGCCAAGGTGTGGTGGTTCCGCCCTAAATC
GCCTCCTCGGCCTTTGTGGGAGTTGGGAAGCTCCTACTTAGAGGGAGGTACGGCGAGCATGTAGGGTAGGGGAACTTGTA
TTCCCACCTAAGCCTGCTCGTCTGCTAGAGGGAGTGAATCTTTCTGCAAACCGANNCTATTCGACTCTACTC
Sequence Type genomic DNA
Unitrap ID UNI22489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54788021..54788571 538
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034928 (Rnf44) NP_598825 ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]


SPLK-Sequence tag 3SP097H11
Sequence
TCTGTACTTGGCTGGCGGGGTTGTGGACCATNNNACAAGAGATAGACTCCTTTGAGTTACACAAACTTTATGGATAGAGA
GCAGNNCAGTGAAGAGAGGTGTGGGAAAGCAGTGGTGCTGGTTGACCTTGAGTGTGTTGATTGGTCCAGCTCAGTCACTC
TTGCGTCTCTGGGACACTACTCACGCATAAAGATACTACATCTCACACGTGGCTCCTGAAGTACTCTGTAGTTTTCCCTC
CGACCACTGTCATTGAGACTACTGGGGCTTTGGGTCTAGGGAACCAGCCAGGAGGACCAATTGTGTTCCCCGTGGTCTAG
AACAAGTCCTTGGGGTTTCAGTAACTGAAATGGGTGTGTCCCCTCTTTACCACTTTAGTTTCTGGCAGGAGTTAAAGAAC
CACCTTTCTGTTCCTCAGGTACACTGCTGGACACCATGCTCGTGCCTCCTTTAGCGCTTAGGGACTTGTGTCTACCTAGG
GTAGGGGTGCAGGAGGAGGCCAACCATTCACACCACAGCTGGCCTTCACTTAAGGCTGCCTCTTCTCTTCCCTTTAAAGT
AGCCTTTGATNGG
Sequence Type genomic DNA
Unitrap ID UNI22489

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 54787420..54787995 542
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000034928 (Rnf44) NP_598825 ring finger protein 44 Gene [Source:MGI Symbol;Acc:MGI:2145310]

 
Come back to gene ENSMUSG00000034928


For any suggestions or comments, please send an email to unitrap@crg.es