Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P097G04
Clone ID P097G04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P097G04
Sequence
AGGGCGCCTCCGAGTTCGTCCATCTAAAAAGGGAGGGGTCCAAGGAGCTGAACTCCTAGCCGCCTAGATTTCCACTGTGG
CTCTGGGTACGAGTGGCAGTTTCTTCTTGGGATTTCAGAAAGGAAACCAAGGAGGAAATAGAGCGCNNNGCATCGCTGTG
GGCATTAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SP097G04
Sequence
GATCTTGGCAACTAAAATGCTGGCTTTCAGACTGCATCGATCACCAGCTACCTTGGTCCATTGGCCATCACGTTTTCAAA
CATATTAAGGAGCACAGAAGATGCACATTGAAGAAAGTGGGAGTTCAGGTTGGAATCTCC
Sequence Type genomic DNA
Unitrap ID UNI11663

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44391939..44392077 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


SPLK-Sequence tag 3SP097G04
Sequence
TTCTGTTTCAATTTTGTTCCAAGTGTTCGTGTGCTTTTTTATCTTATCTCAGTTCCCTAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es