Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P095H02
Clone ID P095H02
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP095H02
Sequence
TTGCAACAAAACTAGGCCTGGCCACCAGGCCAAGCAAGCAGATTGTCTCTAAAAAGCCCCGAACTTGTTAAAAGGCCTTA
AAGGAGCTGAAAGCTGTTCTACCTCTTTTGTGAGGTTGTGAGTACCAACACACACGTTCACAGTCTAACCCGCATCTTGC
AGTTAAGTGCTCAGAGGATGCGCACCTTCAGAGTCATCACAGACTTACCACGTGGGCTTAAAAGGGAACCTTGGTGGCCC
ATCTCAGCGTTTTGCTTTCCTCTCTAAAGCCAAGACAGCAGCCCACGG
Sequence Type genomic DNA
Unitrap ID UNI2209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51032608..51032896 285
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023087 (Ccrn4l) NM_009834 CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ccrn4l-001]


SPLK-Sequence tag 3SP095H02
Sequence
CACAGTTACGTGCGGCAGGGATGCAGGGAGTCCTCTGTGGGCTGGGAGATGCTCCTCCTCCTCAGTTAATGAAGAGTTGG
CTGGATCACGGCTCTCCACCACTGGAACACGGTGCTTTTTCTCTTGGAACAGATTTAAAGGCAAATACCAGCTCAGTAGA
AAAGACATCTTTATTTGGTAGGCCCCTTAACTGTGTGAGTAAGCTGTTTATGAGAAAGAAGTGGGAAAGCTTGTAATTAT
CAGGTTTCTCCAGAATAGATGTTTATCCTTATGGAGAACTAAGAGCTATCATTCTCCTGTAGTAGTCAATGGCGACAGTT
AAAATGCAGAGGGGGAGTGAGAGTGGTGGTTAGGTTAGGAACCAGGGCTCCAGATGGGAAATCGATGAATGAACTTTTAC
AAATCTTTTGACCTTGCTTGCTTTGTCTTAATGCCAGATGGCATCTAGACGAGATTAACACATCAACTGATAAGGCTATA
TCCCCAAACTTTGGTGAACAGTACACTCAACCAAGTGTTAAAAAAAAATGTTCCATATGCTAATGACAGCAGGAGTTGAG
AAGAACAAGCCAGATTGGTTGGGCCAGATTGGTTNNNGGGAAACTTCAAAGGAGTGGGAGAGACAGGGTAGTGGTGGGGC
ACAGAGAGCAGTGTCATTAAAAAC
Sequence Type genomic DNA
Unitrap ID UNI2209

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 51032912..51033575 647
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023087 (Ccrn4l) NM_009834 CCR4 carbon catabolite repression 4-like (S. cerevisiae) Gene [Source:MGI (curated);Acc:Ccrn4l-001]

 
Come back to gene ENSMUSG00000023087


For any suggestions or comments, please send an email to unitrap@crg.es