Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P095G08
Clone ID P095G08
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P095G08
Sequence
CTGTCATTCCCATATCTGCTTTCCGTCTGGACACAACATTGGGTCTAAGAAAATCAGCTCACCAGGCTGTGATCACTGAA
TCACATTGGAGTTCTCTGTA
Sequence Type mRNA
Unitrap ID UNI5569

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32389986..32390085 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 5SP095G08
Sequence
GATCTCGTTATGGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAACTCCTGACNTTCGGAAGAGCAGTCGGGTGC
TCTTACCCACTGAGCCATCTCACCAGCCCTACTTTTATGTTTTTAAGGTGACCAATTGGTGTCCTTTTCCCTGGAGAAGA
TTATTTCTTAGTTACCTGTAGTGAAAGACCNNCGCGACGGTATCATCT
Sequence Type genomic DNA
Unitrap ID UNI29490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32372023..32372204 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]


SPLK-Sequence tag 3SP095G08
Sequence
TCGAGTCTTGCGAGGTTGAGGCTCACTGTCCTCCTCTCCCCCATCCCCATTAGCATGTCTTTTGTTCTACTTGAGCTCAT
GTTTAGGCTGTCATGTTGGTGAGACTTTATAGGTATCACTTCTGACATTACCAGGAGAGTCTAATGGCAAGCTCCCTGGT
CCTCTAGCTCTTAGAATCTCTTTGCCACCTTTTCCACAATGTTCCATGAGCTTTAAGTACAGAAGAAGTGTTTTGTAGAT
ATATCTCATTGGGAGTGGGCTCCAAAAGTCTGCATTTCAGTTGGNTGGTATTTTTAGTTTTGAAAATGGTCTGTGTTGCA
AAGAGAAGTTTCCTTGATGAGGATTGAGGACTGCACTCATTGGTAGGGATAAAACAATGTTTAGAATGTAGTGAGGGATT
AGGCTCTTTTAGTCAGCTTCTCCTCCTAATCTATGACTTCACCTAGCTCTNGAGTAGTGGCTAGGTCTCTTAATACCAAG
CATGATTTCCCNTCCTGTGAGCACGATTATAGAGCTATTGATTTTTACCAAGATATGTGTGCTGTGCCTGTCAGTCATGT
GTTTCATAGAGTTGTAGCTGGATAGGACTGTTGGNTTGCTTCCCTCCTTTGGAAGCTCACGAGGTGCCTTCTGGGACCAG
GAA
Sequence Type genomic DNA
Unitrap ID UNI29490

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 32371382..32372019 605
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024002 (Brd4) NM_198094 bromodomain containing 4 Gene [Source:MGI (curated);Acc:Brd4-003]

 
Come back to gene ENSMUSG00000024002


For any suggestions or comments, please send an email to unitrap@crg.es