Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P095D04
Clone ID P095D04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P095D04
Sequence
ATGGAAATCCTATGACAGACAGTTTGGGTGATATCTGCAGGAAAGATCTTTAAACATTANNG
Sequence Type mRNA
Unitrap ID UNI11641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59289362..59289420 59
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 66011010..66011068 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000056515 (Rab31) NP_598446 RAB31, member RAS oncogene family Gene [Source:MGI Symbol;Acc:MGI:1914603]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108547267..108547325 59
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]


SPLK-Sequence tag 5SP095D04
Sequence
TGGTGCAGGGTGGGGGTGGGGGATTGAGATAGGCTGTCATGGGAGCAGGGCTAGGGCTTTGATATTTTGATTGTTGAATG
ATTTCCACTTTAATTG
Sequence Type genomic DNA
Unitrap ID UNI11641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108546736..108546831 96
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]


SPLK-Sequence tag 3SP095D04
Sequence
CCTTTCTCTTAGAAGAAATACACGCTAATGCATTTGAGAAAACGATAAAAATTGGGGGTAGGGAAAAAAGCAACTGTTTC
TGCAACTTTGCTGGATGTTAAGATGTCTGTGGACATGAACAGCCAAGGGTCAGATAGCAATGAAGAGGACTATGACCCAA
ACTGTGAGGAAGAGGAAGAAGAGGAAGAGGACCCTGGGGACATAGAGGACTACTATGTGGGAGTAGCCAGTGATGTGGAG
CAGCAGGGGGCTGATGCTTTTGATCCTGAAGAGTATCAGTTCACTTGCTTGACCTATAAGGAGTCTGAGGGCGCCCTCCA
TGAACATATGACCAGCTTAGCCTCTGTCTTAAAGGTGAGTTGTTCTGCCAGTTCAAATGTAATCTCTCA
Sequence Type genomic DNA
Unitrap ID UNI11641

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108546322..108546711 386
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000064145 (Arih2) NM_011790 ariadne homolog 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1344361]

 
Come back to gene ENSMUSG00000064145


For any suggestions or comments, please send an email to unitrap@crg.es