Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P094H12
Clone ID P094H12
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P094H12
Sequence
CCTNNNCAGCGCTCCTTTCTCCCCGGCGATCGCCACCGCTTCCTGGAACAGAGACGCCCTTCGTCGGCTCCCTGCGGGTG
ACCGAGGCAAGAACCACAGCTGGTTGTGTGCAGAGGCCAGCCGCCACTACT
Sequence Type mRNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011360..98011484 121
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]


SPLK-Sequence tag 3SP094H12
Sequence
GGCAAGTATCGGTGGGTGCGAGGAACAGGTTGGGGATAATATCCCGGCTCCTAGCAGTCTCCAGGAAGCCCAGCGCGTGG
GATCGGTTCCCCAGGGTGCCTCGTAGCCGGCTTTGGGGGGCGGTGGAGGCCATGCGCAGACCTCCTCCTGCGGCCACTTG
ACTGCAGCCAAATGAATGAAAACTGGTTCCTGAAAAACGAGTTTCTTCTCCTGCAAGCTTTTGCCTTTTAGAATGACATT
ATTAATTTCAAAGGCTAGGTAGGAATTGGTGGGCGGGGTGGAGATGAAACAGTGGACTTGGACTTGTAATTTGGTGTCGT
CCTCACTGGCATGTCCAGCGTGTTGAGAGTAGCCGTTGCAAGTGTTGGAGGGGACGGCGTGGCCAAGAGCTATTTTGGTA
AACATCTTTATAGTGTGGCTCCGTTGTTGTCAGTAATGTGAGTGCTTGGGAACGTCTGCCTGGCTTCTTTGCTCGTGGGA
TCGAGATCAGGCTTAACCAGGAGAGAGATGGAGGTGCTCCCAGTGTTGGAGGCAGACGTCCTGCCTGGAAGCAGCAGGAA
GTGAACTGAAGTCACTGAACTAGGGGCCCTTTTGATGTTCACAGNAATAGCANNCTTTTTCTCTGCCTTCTTNNNAGACG
CAAGGTAAGAATATGTGTGCATTTTGGGGGNCATTTCCTTAG
Sequence Type genomic DNA
Unitrap ID UNI10881

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 98011695..98012377 659
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041773 (Enc1) NM_007930 ectodermal-neural cortex 1 Gene [Source:MGI Symbol;Acc:MGI:109610]

 
Come back to gene ENSMUSG00000041773


For any suggestions or comments, please send an email to unitrap@crg.es