Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P093B11
Clone ID P093B11
Vector rFlpROSAbetageo
Project ggtc

SPLK-Sequence tag 5SP093B11
Sequence
TAGGGAAATGGCAAGTTTCCTACAATATTTGAGTGTACCTGTGTTATTTATGTCTATGATTTGTAAACATAGATAGGGTG
TATAAAGTACAAGGATCATATTGCTGCTCAAAATTAATTTTAAAACATTTTGGACTTTCCCTTTTGGGTTCCTA
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55701616..55701769 154
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]


SPLK-Sequence tag 3SP093B11
Sequence
TTAATGATATTTATTCATGTTTGTTTGTCTGTTTAGTAGTATTTGGGGTTAATCCAGGGCTTCACACATGCTAGGCAAAT
GTTTTTACTACTGAGCTGTAAGCCAG
Sequence Type genomic DNA
Unitrap ID UNI12168

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 55701225..55701323 99
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040721 (Zfhx2) NM_001039198 zinc finger homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:2686934]

 
Come back to gene ENSMUSG00000040721


For any suggestions or comments, please send an email to unitrap@crg.es