Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone P093A04
Clone ID P093A04
Vector rFlpROSAbetageo
Project ggtc

Sequence tag P093A04
Sequence
CGCCGCCCCGGAGCCCCGCAGCGACTGGGACACGGGTCTACGTGGAATTTGATGACCTTGAGTGGGATAAACGGGAGTGG
GTTAGAGTTTATGAAGATTTTTCAACTTTCTTGGTGGAATATCACTTAATCTGGGCCAAAAGGAAGGACCCTAGCCAGAC
TCAGGGATCAAAGAGCAGACAAATTCAGTGGCCTGCACTG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66559432..66620819 166
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000075003 (AC156272.6) Putative uncharacterized protein Fragment [Source:UniProtKB/TrEMBL;Acc:Q3TU60]


SPLK-Sequence tag 3SP093A04
Sequence
TTGTATTTATATATCTTAATGTTTCTTTAACAGGCACTGTAGAGCACCTCTGGTTGGGGAGGGTGTTATGTGAGGTTTAA
ATGGAGCTGTACACGGGGTCACTTGTAAATTAGCCTTTCTATTTGTCATACACATTTACTAGCCAGATTTTACCAAGGAC
TGTCAACTAAATACCTTCAATTTTGAGGAATTGTGTTATCTAGAAATTAATCCTCTTTCTAAGTTAACTGGAGTAATTTA
AATTATGTTAAGTTGGTGAATTTTACCCCTGAAGCCGGCCCACCTTGCAAAAAGGGCTCTGGAGAAG
Sequence Type genomic DNA
Unitrap ID UNI14486

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 66650362..66650669 304
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037876 (Jmjd1c) jumonji domain containing 1C Gene [Source:MGI Symbol;Acc:MGI:1918614]

 
Come back to gene ENSMUSG00000037876


For any suggestions or comments, please send an email to unitrap@crg.es