Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NPX086
Clone ID NPX086
Vector pGT1&delta
Project baygenomics

Sequence tag NPX086
Sequence
CCTTCTCCCGCAGCCGCCTTCCGCAGGCCGTTTCCACCGAGGAAAAGGAATCGTATCGTATGTCCGCTATCCAGAACCTC
CACTCTTTC
Sequence Type mRNA
Unitrap ID UNI1183

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100181385..100181473 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035530 (Eif1) NM_011508 eukaryotic translation initiation factor 1 Gene [Source:MGI (curated);Acc:Eif1-001]

 
Come back to gene ENSMUSG00000035530


For any suggestions or comments, please send an email to unitrap@crg.es