Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M125F11
Clone ID M125F11
Vector ROSAbetageo0
Project ggtc

Sequence tag M125F11
Sequence
ATGAGCAAATAGGGGATAACACATTACTTCGGCCTCNNCACTCAATCTANNNGCTGGCGCGTTTTTTANNTCTTTCCGAG
TTCGGGCTCTGGAAGGCGGAAGTGGAGCGGAGTTAGGCGCCGCTGGTGTGGCCGCGGCAG
Sequence Type mRNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109960277..109960341 61
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]


SPLK-Sequence tag 3SM125F11
Sequence
GGCTCTACTCTTGGAGGGCCTTCCTGCTAAGTTATTCCATGGTAGAAGGCAAGAGAACAAGTGTATGCACAGAACTAGCG
GCCCTGGTAGTGTTCTGTGAGCACCAGGCCTCTCAGGACCTCATTTCTCAGTTCCTCCTTCCAGCCTGTTGCACTAGGGT
GCAACACATACACTTTGGAGACCCATTCAAACCATAGCTTCTGCCACAGTTGTCTTTTCCGAGGAAAATATTCTTCCTTC
AGTGGATGGTTGTACACCCCTACTTTATTACAGGCCTTGTTCTGGAGTTTGGCTGTTCAGTATGGAGGCTGATGATCACA
TAGCTGTCAAAGCCTGGTACAGCCTATGAATGTCAAATACATCAG
Sequence Type genomic DNA
Unitrap ID UNI11412

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 109964201..109964565 365
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031930 (Wwp2) NM_025830 WW domain containing E3 ubiquitin protein ligase 2 Gene [Source:MGI Symbol;Acc:MGI:1914144]

 
Come back to gene ENSMUSG00000031930


For any suggestions or comments, please send an email to unitrap@crg.es