Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M125E01
Clone ID M125E01
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SM125E01
Sequence
AATTTTATATACATATATAGGTTTGATTTGAATACACTATGAAATCCATTATGGCTTACATTTTGTGGACTCTTGAGTTG
GAATAAAGACTAGAAACNNCTAATTATTTTGTTGACTAGGAAGGAGGACTTTGNNNTTCATNNNGTGCAGGCACCCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SM125E01
Sequence
ATGTCCACAGAGGGTAGGTAAACGTAGATCGCTGAGCTGNNATCATGAGAGGATGAAGCGTGGAGAGCGCGCTGACTGAT
CTGCCTTCGAGGAGGAGGGGGAGCTCCAGCTTCCGTCTTACCTGAGGCCCTGCTGAATGGAGGCTGCCATGAGAAAACCC
AGAGCTGCTTGATTCATGATGCTCTGCCTCTTCTGGCCTTGTAAGCTAGGAGGCGAAAGGGAATGTAGGCCTGTTTGGAA
ATAGGAAGTTGATGCCACGGCTTCCATCCCACCAGGGGGCCCCAAGCAGTGATCCCCAGGCCGAGGAGTTCTCCAGAAAT
GGCTTGTGTAACCAGTCATGCCTCGAAGTGCTGAGCAGCCTGTCAGACACAGCGTGGGCAGTGTCTTCGATATTCCTTGC
TTGTCTCCAGCCTGGGGAATGGCTCTGGACAATCTTCTGACTGTGTCAGGCCAGCTTTCTCAATTTCTCACACCTTCCTT
TCTCAGGACTGACAGGTTGAGCTGGTGTGTGACAGGTTGCTTGCAGTATGTGACT
Sequence Type genomic DNA
Unitrap ID UNI5320

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 88141380..88141913 494
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001415 (Smg5) NM_178246 Smg-5 homolog, nonsense mediated mRNA decay factor (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:2447364]

 
Come back to gene ENSMUSG00000001415


For any suggestions or comments, please send an email to unitrap@crg.es