Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M125A01
Clone ID M125A01
Vector ROSAbetageo0
Project ggtc

Sequence tag M125A01
Sequence
AGGGTGAGTAGGAGTGGNNGGTATATGTAGGTGATGGTAAGATTGATGGAAGGANNATTANNTTTGGGTANNANNTTATT
AACGGTGTGAGTTATNNNNGTGGAGTGTATGGGTGTAGAGGTGGCGNNAAGCGGGTGANNAGTTGTCAGTAATGAGCANT
NNAGNNTGGTTGTTTCAGTTTATACGNNGCTGGTTCCCTCCGGAGTCAGCAGGCAGATGCTCCATCAAGGGAGAAGCAAT
CTTCATGTATCATCTCAGGAAGATGCAGCATGACGCAGGCCCAGGGATCGCCTTTCTAATGGAAACGCCAGGGCTCAGGT
TTCCAAGCCTGCCCGAAATATCCCAAGGAGACACACTCTAGGTGGGCCCCGAAGTTCCAAAGAGATCGTGGGAATGCAGC
CATTTGGGGTGGGCAGGAAGAGAGAGGCGTTCCTAGAACATCTAAAGCAGAAGTACCCCCACCATGCCACAGCCATCATG
GGCCACCAGGAGAGGCTGAGGGACCAG
Sequence Type mRNA
Unitrap ID UNI588

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20441521..20451869 266
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


SPLK-Sequence tag 5SM125A01
Sequence
AATTCTCAAAGAACNNATAAAAATGAAATCAGGGTTCAACCTTCATTATTTTCCTCCCTAAAGTTTTTGGTTATTTAATA
CATTGTCTGCTGAGCGCGTGTCCCGGAACTTCATGAGCAGGAGGGAGGTCCCCTTCCTCTTTTGAAGGATGCCTGTTTGG
TTTGCTGACATAAATGGCAACAGGTGTGTTAACAGGCAAAACACAAGGTAATGGGTCCATGAGCATGAAAGTCTTTCAAA
AACACATAACTCAAATATCCCNNGGTAGGGAAGTGAGAAATGGAGATGTGTGTGGGTGATTCAAAAGTTAATAAAGGAT
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20518204..20518525 300
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


SPLK-Sequence tag 3SM125A01
Sequence
ATGAGCCTCCAAGAAAGATAGACAATAGTGTGTGAATTAAGTTGGCCAGAAAACCAATTAAAAGTCTGTCTGAGTGTGGT
GGGGCCCCTTCGTCTTTGTTTCTATGCTGTGAAGTTAATTGTGACTGATTTAAGAA
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20518542..20518679 130
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es