Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M124E10
Clone ID M124E10
Vector ROSAbetageo0
Project ggtc

Sequence tag M124E10
Sequence
GCACATAAATTGGCTATTTTTTTTGGAGTGGATAAGTACAACAGTGACAAATACATGGAACAGTAAAGAAGACCTTGCTC
TTAAATCCAAGGAACCTGGCTAACTCTGGATCTGACCATATGAAAACTTCAAAGTAAATATGGGTAGCTGACTTCAAGTA
ACTCTATGTCAAATAGTCATAGGTTAAGTATCTTCAAAGAACTTGGATATTTCAGAGGATACAAAATAAAAAAACAAACT
GGAAAACATAAAGCTTATAGAGAAGAAATCAACACCTTCTTGTGCAGTCCTTTTGGAATTT
Sequence Type mRNA
Unitrap ID UNI699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112277631..112277931 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]


SPLK-Sequence tag 3SM124E10
Sequence
GTTTCTTCTGAACCCATATCAAGGCTTACAGTTAGTTTATAAGGTATTAATGAGAAAAGTAAAATGCTATTCTGTTTCAA
AAGATAACATTTCATTTCTTGTAGCAACTA
Sequence Type genomic DNA
Unitrap ID UNI699

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 112272638..112272747 110
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032745 (Gpbp1) NM_028487 GC-rich promoter binding protein 1 Gene [Source:MGI (curated);Acc:Gpbp1-002]

 
Come back to gene ENSMUSG00000032745


For any suggestions or comments, please send an email to unitrap@crg.es