Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M124E02
Clone ID M124E02
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SM124E02
Sequence
AATTTAGATCTTGGGCCNNNTTTGAATTAATCTTTGTATGAAGTA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SM124E02
Sequence
GGACACTGTTTCTTGGTGCACTTGTTTAAGTCTGTCCTCTCCTGCCTGTGAATGTTTATTTGGAGCTC
Sequence Type genomic DNA
Unitrap ID UNI11614

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 157202555..157202624 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000063019 (Manbal) NM_026968 mannosidase, beta A, lysosomal-like Gene [Source:MGI (curated);Acc:Manbal-001]

 
Come back to gene ENSMUSG00000063019


For any suggestions or comments, please send an email to unitrap@crg.es