Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M123H06
Clone ID M123H06
Vector ROSAbetageo0
Project ggtc

Sequence tag M123H06
Sequence
CAGAATTTCGAATGTGGCGGCGGTAGCTGCGGAGCGCGGCGGAGCGGGAGCTTGCATCTGCTGGTCCGGACCTGAGTGGC
CGAG
Sequence Type mRNA
Unitrap ID UNI12753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53828536..53828619 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023940 (Sgol1) NM_028232 shugoshin-like 1 (S. pombe) Gene [Source:MGI (curated);Acc:Sgol1-001]


SPLK-Sequence tag 3SM123H06
Sequence
TAAGTTCCCATAGAGCCTAGAATGTTGTACGCCTCCAATGAATATTTACTATAAGATGAATAATTGATACTTTCTGGAGT
TATTTAATACTTTCCTATGAAATAGTAGAAGATAAAGTTATGGCAAAAACATGAATGATATTTTATAGGATTTTTTTTCT
TATGATGGCTTGATTCTAACA
Sequence Type genomic DNA
Unitrap ID UNI12753

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 53827472..53827652 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000023940 (Sgol1) NM_028232 shugoshin-like 1 (S. pombe) Gene [Source:MGI (curated);Acc:Sgol1-001]

 
Come back to gene ENSMUSG00000023940


For any suggestions or comments, please send an email to unitrap@crg.es