Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M123D11
Clone ID M123D11
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SM123D11
Sequence
GATCTGGTACCAGCTCTTTCACAATGGTTCTCACTAATCATGCTTACAGAGGCAGCTGCAGTTGTTGTCTTCCTCAACAA
CTAAGGGAAAGTTAGCAACTTGCCCAGTGGTGCCCAGCCAGACTCCAGAGAGGGCTAAGCTCAGACCTCATTCTGCTCTT
TGGCTCCTCTACAACTCGGGAAG
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100256144..100256327 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es