Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M123D04
Clone ID M123D04
Vector ROSAbetageo0
Project ggtc

Sequence tag M123D04
Sequence
TTGGGAATGGAGTGTGGTGAAGTCCTAGACTTCAGGTTAATGTTGGGAGGTGACCGAGCTTCAATATTTTCCCTTGGTCA
ACGAATGCCTGTTACTATTCCTGCAGTGGGTGTGGGTCGAACTATGTGCTGCTCTCCAAGATCANNNNCCTGGGGCTCTC
TAGACCCGGTACGCCATCTGTGAGTCGCGGGTGGCAGGTGCCTTTTTTTTTCGCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SM123D04
Sequence
CATTGAACTCATGAGAGGTAATATTTNCANAGGACACCTGGAATAGGGTGTGCTCTTGTACAATCAACAGCATTGAGTTG
AGTGAAAGTCTGGGAGCTACGAGGATGAAGATGTGGTCTGTGTTTTGGAAGAGCAGTGCATCTGTGGGCAGGGCTGACAG
AGCAAGCAGGAGCTTACCTGCCAGGACCTACTCTGAGGAGCAGAGTACGGGAGAGGCCCCNTTCGCCAGGGCTT
Sequence Type genomic DNA
Unitrap ID UNI8198

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 59469207..59469440 220
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035168 (Tanc1) NM_198294 tetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1 Gene [Source:MGI (curated);Acc:Tanc1-001]

 
Come back to gene ENSMUSG00000035168


For any suggestions or comments, please send an email to unitrap@crg.es