Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M123C03
Clone ID M123C03
Vector ROSAbetageo0
Project ggtc

Sequence tag M123C03
Sequence
ATAAAGTGTGGATGTTGTAGGTAGAGNNTGNNTGTGTGTTGGGTTTCGTTTGTGTNNTGTCTTATTTGGGTTGAGTAATT
TTTTTGTTAGTCTCTAGCAATGGTGTTTNNNNTGGANNATNNATNNTTGCGGGTTGTTTTTTTATTAGAGGAAGTTGTTT
AAATNNGTATTATNNTTNNCACTTGTGTTTTGTGAGTTANNATTGAATTNNTTATTTCNNGAATTTTTGATTNNGTGGTT
GTTNNATTTGTGGATGGTAAGAAGAGTAGTGTTCCGCTTCAGTCAAGGGGGGCGGTGAGGTTTCGAGATGTCCTTCCAGG
GCATGCTCCGGAAACTGGACATTAAAAACGAAGGCGATGTTAAATCTTTTTCTCGAGTAATGGTCCATGTTTTCAAAGAT
GGCGTAACAAACTGGGGCAGGATTGTGACTCTTATTTCTTTCGGTGCCTTTGTGGCCAAACACTTAAAGAGCGTAAACCA
AGAAAGCTTCATCGAACCATTAGCAGAAACTATCACAGATGTTCTTGTAAGGACGAAACGGGACTGGCTTGTCAAACAAA
GAGGCTGG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SM123C03
Sequence
CATAGTTTGCTTATTTATGTTTAACTCTTCGGACTTCAGAGCACTTTATGTAGGTGAATAAACCCTAGAGGTTGAGGTGA
CTAAAAGGTTAGCCTCTCATAACCCAGCCATGGAAGTTTTGTTTACTAGGAGCCTGACTTCCCAGCTCACAAAGGGTGAA
ATGAAAGCTGAAGTACAGACAGGATCTTAGTAGGTATTTTAGGTCCAGGGCCATGAAGACTTGGAGAGCGCAGTGGCTGG
GCAAGGGGCTGCTTTGGAGGGAAGAAGCATGTGGTCTGAGTGCTGACTAGATGAATAGTTGAGGCACATCCTTCAGAGAA
GAGGGAGGGGCTGCTTGGAAAGATGGCTCTCAGCAAAATCTGTTTGTCTTACACGTCTCTCAGGGAAAAAACATGCAGTC
TTCAAGCATCTTCCATGTACATTCTATCTGGGTGAACACCTTCATTCTGGTAGAGCACCTAACACTTTAACAGCTGTTCC
CGAAAGGGTTAGGACCAACTGCAAGTTAATGTGGGTTGTAAATGTTCCCCTAACTTCTGTTTCTTCTGAAGAGAAAATAA
ACCTTTTTCCCCCCAAAGTAAGGTGTGGTATGGGGCTTTTCTTATCGCCTTCCTCTCTTGTGCAAGCCTTTTAGGGAAGT
CAGTTGAACAAATA
Sequence Type genomic DNA
Unitrap ID UNI531

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95466526..95467179 650
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038612 (Mcl1) NP_032588 myeloid cell leukemia sequence 1 Gene [Source:MGI Symbol;Acc:MGI:101769]

 
Come back to gene ENSMUSG00000038612


For any suggestions or comments, please send an email to unitrap@crg.es