Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M123A05
Clone ID M123A05
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 3SM123A05
Sequence
ACTCTCACTCACCAGGGCTTACTGATAAGTAAAGGAAATA
Sequence Type genomic DNA
Unitrap ID UNI23374

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 30792175..30792214 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015971 (Actr8) NM_027493 ARP8 actin-related protein 8 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1860775]

 
Come back to gene ENSMUSG00000015971


For any suggestions or comments, please send an email to unitrap@crg.es