Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M122H11
Clone ID M122H11
Vector ROSAbetageo0
Project ggtc

Sequence tag M122H11
Sequence
TGGTGAAGCCCTTCAAAGTGATAGCGGAGACTTTGGAAGCACCATGGATGGGTTTTGTGATCAGCAAGTCCCTTTTATGG
TCCCAGGGAAATCTCGATCAGAGGACTGTCGAGGGCGACCTTTGATTGACAGAAAGAGGAAGTTTGTGGACGCAGCTTCG
CTCCCTTCCTGAACCTGGATCACAGCAACAAACATTTGCGGTCCCCCGGCCACCACATCAGCCCCTGCAAATGCCAAAGA
TGATGCCTGAAAGCCAGTATCCATCAGAACAGAG
Sequence Type mRNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22411706..22436598 111
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]


SPLK-Sequence tag 3SM122H11
Sequence
TTTNNATCTTAGCATTCTGATGGGTGAGGTAGAATCTTACAGTAATGTAGTTTGCCTTTGTAGCTAAGGAGAGGACGCTT
TGAAGCGCTCTTGGCTGCATGTAGTTCTTCTAGTCCACATTTAATGGGATCATTTGTTTTCTTGGTGTTTCGTTTAGTTT
TTGCTCTTAGTATATTGTATATACTAATCCTCTGGCAGGTACCACCTAACAGGTGGCCTTTTCAGTCAACAATAGCTTCC
TGCAGGGCAGAAACTTG
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22403967..22404224 250
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es