Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M122H05
Clone ID M122H05
Vector ROSAbetageo0
Project ggtc

SPLK-Sequence tag 5SM122H05
Sequence
AATTCATCGCCCTCGCCGACCGCATTTATGTATGTATCTGTTTGTGCAGGCTAGTCTAGCATC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SM122H05
Sequence
CTGAAACATAGGGTGTATTTTTGTGTGTCTGACCCTGGGGGCTTGCCCAATTGGCTCTTCGTGGAGATGCAGAGCTAGCT
TGGATCTGGGAGGTGAGGAGAACAGTGAGTCTCATATTTTGTCCCTGTCTTCACTCTGACAGCCCACACAAATCCTTTCT
CTCGGTTTCTGAGGCTCTAGGATTAAGATGGAGCTAAAGGTTCAGACTCTGTCAGAACTGATACTCCAGTCGGGACGCTG
ACTCTACCCAAAGACTAAGAGTTTAAAGTTCACACTCAAGACTTCCTGGGGCTCTAG
Sequence Type genomic DNA
Unitrap ID UNI29546

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 41640820..41641116 297
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028444 (Cntfr) NM_016673 ciliary neurotrophic factor receptor Gene [Source:MGI (curated);Acc:Cntfr-002]

 
Come back to gene ENSMUSG00000028444


For any suggestions or comments, please send an email to unitrap@crg.es