Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M122H04
Clone ID M122H04
Vector ROSAbetageo0
Project ggtc

Sequence tag M122H04
Sequence
CTCCATCTTCCTCTGGCTGCCGGTGGCAGCNNNTGTTTGGGGAGCGGGGTTGAAAGACACCCAGAAGTCTTCATGGATAT
AGTTGATACATTTAATCATTTAATTCCTACTGAACACTTAGATGATGCCCTATTTCTAGGATCCAACCTGGAGAATGAAG
TCTGTGAGGATTTTAGTACAAGTCAAAATGTCTTAGAGGACTCGCTGAAGAACATGCTCAGCGATAAGGATCCTATGCTA
GGATCTGCAAGTAACCAGTTCTGTTTGCCTGTTTTGGATAGCAATGATCCCAATTTCCAGATGCCTTGTTCAACAG
Sequence Type mRNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30919832..30930469 268
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]


SPLK-Sequence tag 5SM122H04
Sequence
ACATCTTTTCTACTCTGGCTTTTTAAGAAACTTGTTCTAAAGTTTTGCTTTTTTGACATGCACTGCCATATTTTCTTTAA
AAATTGAATTGTGAAAGCTGTTAAGAACACTCTAAATAGCATCCTAGTGTCACAGGGACAGTTTTCCTCTGTTGCATGTA
AC
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30910289..30910450 160
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]


SPLK-Sequence tag 3SM122H04
Sequence
GCCAGCTATGCAGTAACGTGATCTACTCTCCCTCATTGGGAG
Sequence Type genomic DNA
Unitrap ID UNI5500

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 30910225..30910266 42
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048874 (Phf3) NM_001081080 PHD finger protein 3 Gene [Source:MGI Symbol;Acc:MGI:2446126]

 
Come back to gene ENSMUSG00000048874


For any suggestions or comments, please send an email to unitrap@crg.es