Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M122F10
Clone ID M122F10
Vector ROSAbetageo0
Project ggtc

Sequence tag M122F10
Sequence
GTATGTNGTGTGNNAAAAATAGAATTATANNTAGNNAAAATAAATTTNNAGGTGAGAGANNGGGANNTNNATGAATAGNA
TAGGANNTANNNNAAGAAGAGGGGAGGATGANNGGTNNAAAGGGATTATACTTGAGNGGAAAGGGAAACATTGTAGGGTG
NNGGGGAGTAGTTATTGTTATTGATGTAGGAAGGTTTATGTGCAGTTTNNAAAGGGAGGGGTAGATTAANNNAATGGGTA
TAATTGAGATCATTGTTTTGTGCAAATCAAGTCTAGGCTTTTAAAAAGAAGGCNNNGTTTTNNTGGTTTTTCTGGTGCAA
TCAGCACAAATTACTCCGCGTTAAAGATGGGGAGAGCGGCTGAAAGGTTTCATTAATGAACAATTTCAGATGATTGTTTC
AGTCTTTACTTGACAGGTTACGTTCGCATGTAGGCAGGCGGGGGTACGATCTAGGGAGGAGCATTATTCTATCATCATCT
CAGGAGGATGTATCATCACGCAGTTTCAGAGATAGCTTTTCTAAAAGAATCATCAGGTCTCAGTTGTCCAAACCTAACCG
AAATATGTCAAGGAGNCACACTCTAGGGGGAACCGTAAGTTTCAAAGGAATGCTGGGATATGCAGCCATTTGAGGTGGAC
AGGAAGAGAGAGGCGTTCCTAGATCATCTAAAGCAGAAGTACCCCCACCATGCCACAGCCATCATGGGCCACCAGGAGAG
GCTGAGGGACCAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SM122F10
Sequence
TGTCGCCCTTCTCTTTAGTGTATGTCTCCTTATGGATTATAGACACCATGAGGAAGAAAGTCATGACTGCATGCTGCGTC
ATTCTCTCCTTAGTCCCAAGCCTATGCCTGGATCATAGAAGTAGGGTTCTGATGGATATTCATGGAAATGTGAATGAATA
TAGAACACAATTCATATTTGTTATTTATCATAATTCCCTGGGTTATTTATGGCTCTCCATATACATCATCAATTAATTCA
GGAGCTGTTTGACATCTCCCAGTGCCTAACACCCTGATTTCTGGACAGTGCTCACCCCCATGGTTTATGTTCATGGAGTA
TTATCTATTAACAGGTAATGGACATTTGACATACTTACTCCCTAGCATAGCAGTCTAAACAGGTAGTTCACAGTGAAATT
ATATTAGGCAATGTGTAGGTGGGGTTATTACTTGTCTGCAGATTAGCAAGGAAGATGAAAAACAAAATTATGCAACTTAC
TGA
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20582128..20582610 483
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]


SPLK-Sequence tag 3SM122F10
Sequence
ACAGAAACATCAATGGTGATATTAACATCTCCCTCACTGTGTAGCTTACTGAATTATAAACAC
Sequence Type genomic DNA
Unitrap ID UNI16328

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 20582628..20582691 60
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es