Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M122B04
Clone ID M122B04
Vector ROSAbetageo0
Project ggtc

Sequence tag M122B04
Sequence
GTTAAGGAGGTCNNAGGGGGGNNGTTAGTTGCTCCNGGGAGCTGGNNGCAGTCTCTCGCGTGGGCAGGGGAGGGCGCATC
CGGCAATGCCTGGATATGCGGGCTGGGGTACAGAAGAGTGGGGCTCAGTCCTGCTCCCCCTGATGAAGTGTATGAGCCTC
CTGTTCTGGTCTCGTTGAGAATGTGGACCTATGCCCCCTCCCATTTGTGAGGGGGTGGGATAGAAAACCCCCCTCAGCCT
CCTTAAGTGGGTTTGGTGTCTCTTCAAAAGGGTGAGGTGGCTTTGACCCCGGGTGGCCCGGCCAGCGCGACCGAGGAGGT
GGCTGGACAGCTGGAGAATGAACGGAGAAGCGGACTGTCCCACAGACCTGGAAATGGCCGCCCCCAAAGGCCAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SM122B04
Sequence
TTTTTGCCCGGGTGGGGGAAGGAGGCCGGAGGGCGGGAGCTAGCTGCACGCGGGAGCTGGGAGCAGTCTCTCGCGTGGGC
AGGGGAGGGCGCATGCGGCACCGCCTGGCTCTGGGGGCTGGGGTACAGAAGAGTGGGGCTCACTCCTGCACCCACTGATG
AAGTCTATGAGCCTCCTGTTCGGGTCTCGCTGAGAGTGTGGACCTATGCCCCCTCCCATGTGTGAGGGGGTGGGATAGAA
AGCCCCCCTCAGCCTCCTTAAGTGGGTTTGGTGTCTCTTCAAAAGGGTGAGGTGGCTTTGACCCCGGGTGGCCCGGCCAG
CGCGACCGAGGAGGTGGCTGGTCAGCTGGAGAATGAACGGAGAAGCGGACTGTCCCACAGACCTGGAACTGGCCGCCCCC
AAAGGCCAAGGTATGGTCCCCAGCCTTCTCTTTTCAAA
Sequence Type genomic DNA
Unitrap ID UNI14831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102177635..102178077 410
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]


SPLK-Sequence tag 3SM122B04
Sequence
CACGAGCTCTCCGCCTTGTAAAAGGTTCCTCTCAGGCTTCGTTCTGTGCACTGGNAGGGGGGCTTAAGTCTTAGAAAGTG
AGGCATCTGTCACATGGGGGTTTGGCCAAATCCAAATTACTTGGCCTTGAGCTTAGAACTTGAGTCTTTACGATCTCTTG
CTATGAATGAGGGTCACAGGGAAGACTCTTGGAAGCCAGCCTTCTTGGTTTCTTAGCTTGAAGTATCACACCTTAGTGGA
GATTTTCACTAGAGGCAGGTGGAAAACAGGGAAGGGGATTGTGGTTTATGGCTCCAAGCCTTAGGAATTATAGATGCCCC
GACCCTAGCCACCTCTGTCAGCAGTGTTATGTTTATGACATGGAGGGTAGTAGGAAACTGGGCATCTGCCAATGCTTGTG
AGACATCAGGGGAGAGAGGATTATGGGCCATGTGACCCTTTTCTGCGGAAACCGGCCCAGGTTACCAGATGCAAATGAAA
GTCAGGAGCTCTTTTGCATCCTGGCCAAGGGTTCCCCCAGCCCAGCCTCCATAGCAAAGAGGCTCAGAGCTGTCTCTGGG
CTGCACTTTAGCAGCTGAAAATAATTGGGCTAAGATGTCAACTTGGAGTTCNNNGGTTCTCCAGAGACCAAGGCCCTGAG
AAACTCTGTCCACCC
Sequence Type genomic DNA
Unitrap ID UNI14831

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 102176965..102177618 625
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020923 (Ubtf) NM_001044383 upstream binding transcription factor, RNA polymerase I Gene [Source:MGI (curated);Acc:Ubtf-002]

 
Come back to gene ENSMUSG00000020923


For any suggestions or comments, please send an email to unitrap@crg.es