Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone M122A01
Clone ID M122A01
Vector ROSAbetageo0
Project ggtc

Sequence tag M122A01
Sequence
ATTGTAATTGCGGCTGGGCGGCCGCTGCCCGTGCAGCCAGAGGATCCAGCACCTCTCTTGGGGCTTCTCCGTCCTCGGCG
CTTGGAAGTACGGATCTTTTTTCTCGGAGAAAAG
Sequence Type mRNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101413083..101413196 112
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]


SPLK-Sequence tag 5SM122A01
Sequence
AATTCACAGAGATCCACCTGCCTCTGCCTCCTGAATGCTGGGTAGTTGATTAGTTTTGAGACAGAGTCTAGTCTCATTTA
TATTAGCTCTGGCTGGCTTGGAGCTGTGTATAATAGAACAGGCTGGTCTTAAACACTCCTCCACCTGCCCCTGTCTCTGG
GGAGGAGGGGGTCAAAGATATCCACTACCATTCTCAGCTAGTTTTAGAGTTTGTGAGACAGGGCCTTCTGTAATTGGGTT
GTGTAGCTCTAGGTGACCTTGAACTCTATCCTCCTGCCTGTACTTCCTGAATGCTGAAAGTACAGG
Sequence Type genomic DNA
Unitrap ID UNI10712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 101412125..101412430 306
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000017146 (Brca1) NM_009764 breast cancer 1 Gene [Source:MGI (curated);Acc:Brca1-001]


SPLK-Sequence tag 3SM122A01
Sequence
GTTTTGATTCTAAGCAAGAAAAAGAACACCAGACTCTGGGGAAAGTTCATATATATATCACTTCTGTCCAGTCACTCCAT
TTTAGCTTTTTTTTTTTCCTTGAAAAAAGGAAGGGCCCCCAGGAAGGTTTTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000017146


For any suggestions or comments, please send an email to unitrap@crg.es