Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H011B08
Clone ID H011B08
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH011B08
Sequence
TAAAGTTTTAAAAATACAAAAGAAGGGAAAAGGTGAAG
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49780880..49780917 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]


SPLK-Sequence tag 3SH011B08
Sequence
AGAAGTGATTGAGGTAAGATATCCCTCTGGCCTCTACAAGCACCAGGACTTAAATGCAAACACCAAGACAACTCCGCAGA
GAAGGACTG
Sequence Type genomic DNA
Unitrap ID UNI10762

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 49781299..49781387 89
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037851 (Iars) NM_172015 isoleucine-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:2145219]

 
Come back to gene ENSMUSG00000037851


For any suggestions or comments, please send an email to unitrap@crg.es