Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H010G11
Clone ID H010G11
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H010G11
Sequence
AAGAGAGANNNGAACAGATGAAAGAGGGTGAAGAAACTGAAGGCTCAGAGGAAGAGGACAGAGAAAATGACAAGGCTGAA
GAAANNNCAAATGAATCAGTTCTTGAAAAAAAG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SH010G11
Sequence
GATCTGGTCCTTGCGAGTGCCTGGGGATTTTTTTTTCCATTATAAGATGAAATACAACATTATAATTAT
Sequence Type genomic DNA
Unitrap ID UNI10703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116278139..116278207 69
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 3SH010G11
Sequence
CTGAGATGAGTGACACCTTATTGTGNNNGCACATTTGGTAGGCTTTAGGGAGAAGGCCTGCATTTTGAATTGCAGCCAGG
TTTTGTTGGTGTTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es