Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NPX206
Clone ID NPX206
Vector pGT1&delta
Project baygenomics

Sequence tag NPX206
Sequence
TTNNGGNTCCTTCCTCCCCAGGAGTGCGGGCGCCCGCGGGAGGCCCCGTCGTCGCCGCCTGGGACCCTGGCCCAGCTACG
CGGGTCGCTCGGGACGTGCGGCGGTGTGGAGTGAG
Sequence Type mRNA
Unitrap ID UNI4738

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 20149310..20149416 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044066 (Cep68) NM_172260 centrosomal protein 68 Gene [Source:MGI (curated);Acc:Cep68-001]

 
Come back to gene ENSMUSG00000044066


For any suggestions or comments, please send an email to unitrap@crg.es