Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone NPX246
Clone ID NPX246
Vector pGT1&delta
Project baygenomics

Sequence tag NPX246
Sequence
CCCTGTGCCCCGCCCCTCCGGCTAGGTCTGTGGCTTCTGCGGCTCCTCCCGGCTGCTCCCGGCTCCTCTCTGCCCTCTCC
CGGCTTCCTGCGGCTCGGCTTGGGCTCGGCGGCGGCGGCGG
Sequence Type mRNA
Unitrap ID UNI9754

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 109834323..109834444 118
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032479 (Mtap4) NP_032659 microtubule-associated protein 4 Gene [Source:MGI Symbol;Acc:MGI:97178]

 
Come back to gene ENSMUSG00000032479


For any suggestions or comments, please send an email to unitrap@crg.es