Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H009A07
Clone ID H009A07
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H009A07
Sequence
CCCAAATGGAATGAAGAAATACTGTTCAGGGTCCTTCCACAGCGNNCCCGCATTCTTTTCGAAGTGTTTGATGAAAATCG
TTTGACAAGAGATGATTTCCTAGGTCAAGTGGATGTCCCTCTCTATCCTTNNNCNNNTGAANNNCCAAGAATGGAGAGAC
CATATACATTTAAGGATTTTGTTCTTCATCCAAGAAGTCACAAATCAAGAGTTAAAGGTTATCTGAGATTAAAAATGACT
TATTTACCTAAAAATGGCTCAGAAGATGAAAATGCAGACCAGGCTGAGGAGTTAGAG
Sequence Type mRNA
Unitrap ID UNI3734

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72525309..72560073 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 5SH009A07
Sequence
GCTGCTTTTCTTCTGACGTGTCCCTCCGTACATGTAATTTATCTTGATCACAGTCACTGCCACTATCTGCCTTCAGCTCC
CTCCCCCTCCCCATCACCTTTTCCTTTGTAATCCACCTTTGTGTCTTCTTTTATTCTCCTTAGTAAATTCACTTTTATTG
ATAAGACCCTATTTTTCTGAGAGCAAAATAGCCATTGGCCACATTCAATAAAGAAAT
Sequence Type genomic DNA
Unitrap ID UNI4497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72563338..72563554 217
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]


SPLK-Sequence tag 3SH009A07
Sequence
AGCACATTTTGATGGTCTACAAGAAAGGAAGACAGAAAAAAAATGGAGATGAAGTAAGAGGAAAAGAAGAGAATAGAATT
TGGGTATCAGCTCCCATAGCAGTGAAACGAGAAAAAGAGACCACACGTGATGGGGTCCAACTTTAGCTTCCCACATAGAA
TGCCCTCCCAGTAATTCTCTGGTCCTCCCTCCATTCCCTAAACTCCCTCTTCCTCTCAGCCTCCACCTGCTGCTCTTACT
G
Sequence Type genomic DNA
Unitrap ID UNI4497

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 72563904..72564144 241
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032216 (Nedd4) NP_035020 neural precursor cell expressed, developmentally down-regulated 4 Gene [Source:MGI Symbol;Acc:MGI:97297]

 
Come back to gene ENSMUSG00000032216


For any suggestions or comments, please send an email to unitrap@crg.es