Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H008G08
Clone ID H008G08
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H008G08
Sequence
ATCTGCCATTTTCTCTACCTGAGTGAGTCTCTGCTGTCCGGAATTCTCTGGTTTTCTTCGCAGGCAGTGTTCTGCCCACT
GGCCCACCACCTCAGGGGAACGATGGCCACAGAGTCTACAGCCGCTGCTGCCATCGCCGCGGAGCTGGTTTCCGCTGACA
A
Sequence Type mRNA
Unitrap ID UNI1110

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116299937..116300097 161
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]


SPLK-Sequence tag 3SH008G08
Sequence
AAATCAGTGGGTCTCTAACCACTCAACCATTTGGGAAAGTGCAGTTTTACCCTCAGATTCCACTTTCCTAGGTCCTCTTC
ATTGATATTTTTAGGGCCAGAGTAGATAAAGTTTAGGAATTCGGTAGAAACTCCATTTCTGGTGCTTTCTGAACAGCTGC
TTGTATTACGTTGGGG
Sequence Type genomic DNA
Unitrap ID UNI16731

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116298570..116298745 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es