Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H008E11
Clone ID H008E11
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H008E11
Sequence
GCCNNNGCCCCCAGCGCAGCTGTGCCACAGCCGCGAGGAGACCGGCCGCCTGACTTCCCTCCTCGCTGGCCGCCGTGTCC
TCG
Sequence Type mRNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 65887195..65887271 75
 
EST/CDNA Est Name
  AK169767.1
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30062580..30062656 75
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 13380245..13380321 75
NO GENE  


SPLK-Sequence tag 5SH008E11
Sequence
AAAGGAATGCACCGCCATGTCTGGTCTAGGAATTTCGTTTTTATTAGATA
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30065238..30065287 48
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 3SH008E11
Sequence
TCCATAATTTTGGATGACCAAGGAAGAGCACATGACTATTTTCATATGTTGCTCCTACCTGAGAGTGCAAAATGCTAAAA
TACTTTTTATCTCCTAGGGTTACAGGTTCATCTAAAGAGGATTTTGTTCCATGTACTTCAGTTGGCTATAGGGTAGTTTT
CTCTTAAAAGTACTCTCTAATCCAAGTCATAAAGACCTTTTCAGGCATTGTGAATAAATGCCATTGATTCTGGCTTCAAC
TGCTTAACTGTGATGTATTAAATAATAGTATTAAATGCTAGGGTCTTCAGAAAGGTTCCTTTATGAAACACGTGATTTTT
GTCCCCTGTAAAATTTTGTATTTTGGGGGGAAAGGGGATGATATTGAACCTGAAAAAAGTTGCATGTGAG
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30065503..30065892 390
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es