Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H008C06
Clone ID H008C06
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH008C06
Sequence
TTATGTTTTGAAACCTCAGATTCAGCAGAAAGGAATTTAGGTGATTTGGACAGCAAGGAT
Sequence Type genomic DNA
Unitrap ID UNI19195

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62707502..62707561 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020064 (Herc4) NM_026101 hect domain and RLD 4 Gene [Source:MGI Symbol;Acc:MGI:1914595]

 
Come back to gene ENSMUSG00000020064


For any suggestions or comments, please send an email to unitrap@crg.es