Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H006F06
Clone ID H006F06
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH006F06
Sequence
GATCTCTCCTCTCACTTATGACAGGTACTACCAGCCTTTCCTGTCGCTCNNNGGCATTGGGAGCTCTAAAGGAGATGGTG
TATTTGGAATCCCTGCAGTGTCTCTGGACTCCNAGTTCCTGGTAGCAGACAGGGCACACAGGTGGCTCAGCTAAATGGTA
AAAGGAATAGTTAAGATAAAACAAGGTGGTGTGTGATAGGAGACAGAAGGCCAAAGGCCTGTTAAATGCTATGTATAATG
AGAGCACCAAGTTAGCATTGGTG
Sequence Type genomic DNA
Unitrap ID UNI29556

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 162782009..162782271 251
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000035576 (L3mbtl) NM_001081338 l(3)mbt-like (Drosophila) Gene [Source:MGI (curated);Acc:L3mbtl-001]

 
Come back to gene ENSMUSG00000035576


For any suggestions or comments, please send an email to unitrap@crg.es