Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H005E06
Clone ID H005E06
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH005E06
Sequence
GATCTTTGTGAAGGACCTTACGGGGAAAACCATCACGCTCGAGGTACGGGCCACCTTGCCGTTGAGGAAGCCAAGGCCTG
ACTGAGGCCCTTAGTGTTTGAGGGCGGGTTTCTGAGTTTTGAGTTGTGAAACTTGGCTTTGAGCTGAGATTATGGTGCTT
AGCAAAAACAACGTTTGGTTTTCGGTGTGGTACGGTTTAGCCTGCTTTATCCCGAGTGGCGAAATGTAGGGTAGGTGATG
GGAGACGCTTTTCTCCGGGCAGACGCGTTCCTGTGCTTCCCTCGGCGTCGCTCGTCCTAGTATG
Sequence Type genomic DNA
Unitrap ID UNI15305

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 29447420..29447723 292
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020460 (Rps27a) NM_001033865 ribosomal protein S27a Gene [Source:MGI (curated);Acc:Rps27a-003]

 
Come back to gene ENSMUSG00000020460


For any suggestions or comments, please send an email to unitrap@crg.es