Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H005E02
Clone ID H005E02
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH005E02
Sequence
GATCTGGTCCTTGCGAGTGCCTGGGGATTTTTTTTTCCATTATAAGATGAAATACAACATTATAACTAT
Sequence Type genomic DNA
Unitrap ID UNI10703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 116278139..116278207 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028693 (Nasp) NM_016777 nuclear autoantigenic sperm protein (histone-binding) Gene [Source:MGI (curated);Acc:Nasp-001]

 
Come back to gene ENSMUSG00000028693


For any suggestions or comments, please send an email to unitrap@crg.es