Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H005D01
Clone ID H005D01
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH005D01
Sequence
GATCCCTTTAAGTCCTTTCTCTGGGCTTGGTTCATTGCTTCTGTGAGCTTGTAAGCAGTGTTTGGTAATCTGTCATGGAG
CACTGGAGTTGCTCGTGTCCTAGAGGCAAGGACGGTGGGTACTTAATAGAAAAAACAGCATGTATTTTAGTGGAAGCTTC
AGTTACAGTTCATGTCTTTCTATATTTCAGGTCATTTATTAAGTTATTGTTAAACTTT
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855139..97855356 216
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]


SPLK-Sequence tag 3SH005D01
Sequence
AGCTTTCTCTGTATCCTCTTCATAGTGCAGGATGAGTAACGAGGAATTATCAGCCACTCCCGCCACAGTCACATAATGCT
TGCGTTCTGACTGTACGACATCTTATATTTCAGCCATGAGTCGGGTTTGCTTCCCCCAGGACCCCCGAGTTCCTCTCTGC
CTTCTTTAGAGGTAGGATGGAGGCTGCCTGTTACCCATGCATTGAAGAGAGGCTGAGCTTACAGAGTGAATAAGCGCGTG
GAGGAGGGAGTCTCTGAGTGCAGTTTGTGCTCTTCCCCAGGG
Sequence Type genomic DNA
Unitrap ID UNI14955

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 97855379..97855663 258
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041817 (B230112C05Rik) family with sequence similarity 169, member A Gene [Source:MGI Symbol;Acc:MGI:2444268]

 
Come back to gene ENSMUSG00000041817


For any suggestions or comments, please send an email to unitrap@crg.es