Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H004G03
Clone ID H004G03
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH004G03
Sequence
TTTTGCAGTAGATCATTGTTTTAATATCATTATAATCATTGAAGTATATTAGAAAACAGTTTTGAAATCTCTGGGTTTTG
ATTAACTTTCTTATCTCTAGAGGATTGTTTAGGCTATGGGGGTGGGGGTGTAAGCCTAGAATGCTGTTGGTTAACTTCTT
AGGAATGGT
Sequence Type genomic DNA
Unitrap ID UNI2225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 93960183..93960353 159
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042167 (Papd4) NM_133905 PAP associated domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2140950]

 
Come back to gene ENSMUSG00000042167


For any suggestions or comments, please send an email to unitrap@crg.es