Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H004E06
Clone ID H004E06
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H004E06
Sequence
CCANNNACACCAGCNNNNNCACACANNNNCNNANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAGAGAAATTANNNNNNGAGGANNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNGCGCAGCTGTGCCACNNNCGCGAGGAGACCGGCCGCCTGACTTCCCTCCTCCTTNNNNNNCGTGTCC
TCG
Sequence Type mRNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 5SH004E06
Sequence
TCCAGCCACATCTTTAGAATTGTAAAGAAGGCACTTTGTTATCCCTGTCCACTATTGGTGTGATAGCGTGTGCCTTTTAC
ATTATTTAATACTCAAGGATGTGCGTGTACTTTTAGACCTTGTCTGATGCCTTTCTCCAGATCAAGCAAATAGAACAGAA
TTGCCTTTCGTCTTGGTTC
Sequence Type genomic DNA
Unitrap ID UNI9789

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 30064277..30064455 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000029131 (Dnajb6) NM_001037941 DnaJ (Hsp40) homolog, subfamily B, member 6 Gene [Source:MGI (curated);Acc:Dnajb6-001]


SPLK-Sequence tag 3SH004E06
Sequence
AAAACTGACACTTTGAAAATGATTGTATGTTAAGTCTTAAATTTACCCAGGACACCATCTGGTAGTGAAGGGCCTACAGG
TAAAGGCAGGATTTTGTAGGAGGGATTAGAGTGGCAAATTAATATTATTTTCATGTATAGAGTTTAAGAGAGTAATTTTG
GAAATAAAGTCACAGTGAGCTGTGTAGTGTTGTGTGTAGNCCTTGATACCAGTCATTCAAGAGGGAGAGGTAGAATTTTA
GGGAGAGCCCATCTTGGCGTGTAAAGTGAGACTCTACTTCAAGCAGTAAGCCTGAGGCTAACCAGAAACGAGCTGGTGAG
AACAAGACGGGAATGTTACTGTTGTAATTGCGCTGGTGAGGTGGTCTAAGCACCNTACAGCATAGCAAGAAGGCCTGAGG
ACTAGAGATGGTACCCAAATAAGCATGACAGGAGGCCGTTGACTCATAGCTGTCGCGGGGACTCCACAGGTGTGCCCCTC
CCCTAATGACTCTGAGAGGGAGAAATGGACCATTTTCTCCTGATGCCACAGTCTACTGATTCTGAGAGCTCCCCAAGCAT
GATTAAGTCTGCTAAAAATCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000029131


For any suggestions or comments, please send an email to unitrap@crg.es