Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H004C05
Clone ID H004C05
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H004C05
Sequence
CCGGAGCAGGAGCTCGTCNCTCTAAAAAGGGAGGGGTCCAAGGAGCTGAACTCCTAGCCGCCTAGATTTCCACTGTGGCT
CTGGGTACGAGTGGCAGTTTCTTCTTGGGATTTCAGAAAGGAAACCAAGGAGGAAATAGAGCGCACCGCATCGCTGTGGG
CATTAGAGAAATGGACTAAGAGCTGGGACACGTGGCAAAAGAAGATAGTCTTCTTCTCTCAATAGAGTGAGTGTGCAGTG
CAGCCAGCAG
Sequence Type mRNA
Unitrap ID UNI369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44389830..44392363 140
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


SPLK-Sequence tag 5SH004C05
Sequence
TGGTAAACTTTTTTGAATCATAGGAGAACTAGGAGAAAAAGAAATGTAAAGAAATAAGCTGCAGTTATATTGTAGATGAA
TGTATTGAGAGAGGCTGCTTTTGTATAGCAGCCTAGACTTGATCATGGCCTAAGATTTTGCTGGTTAAATACTCTTAGAT
ATGGCCTTGATAAATCAGGTCAGTTTAAAGAATAGGT
Sequence Type genomic DNA
Unitrap ID UNI14923

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 44388009..44388205 197
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000051176 (Zfp42) NM_009556 zinc finger protein 42 Gene [Source:MGI Symbol;Acc:MGI:99187]


SPLK-Sequence tag 3SH004C05
Sequence
CCCAGNNNATTCAGCCTAAGCNNCTGGGATCATAGATAGGCATGTCTCTGTCCCACGCTAAGATATATCCCAAGCGTGTG
TGTGTATGTTGAAAATATACACTCTTGCCCTAGCAACTGAAATGTGCTTTGTTCTCTCTGTGATATATATATCTTTGTGC
CAGATTTCCATGATATGTCTCTGAGATGCTTTTTTAAAAATGTGGCCATTTCAAAGTACTTTCAAGGTGATAACTCTCCC
CCCAGAGCTTTCCCGTGTGTCTATATATAGAGAGCATTTAATTTCTGCTCCCACAGATAAGACGTGAGAAAAAAGAAGAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000051176


For any suggestions or comments, please send an email to unitrap@crg.es