Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H004B04
Clone ID H004B04
Vector FlipROSAbgeo0
Project ggtc

Sequence tag H004B04
Sequence
GCCAAGCTTGAGAATGCCAGACTCTCCTCAGAGATGAACACTTCCACTGTCAACAGTGCCCGGGAAGAGCTGATGGAGAG
CCGGATGAGGATCGAGAGCCTCTCCTCACAGCTCTCTAACCTGCAGAAAGAG
Sequence Type mRNA
Unitrap ID UNI2422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56892864..56892991 128
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]


SPLK-Sequence tag 5SH004B04
Sequence
CACTTCCACTGTCAACAGTGCCCGGGAAGAGCTGATGGAGAGNNGGNNTGAAGAACGATAGTGTCGCCTCTATGTCGCTC
TAACCTGCAGAAAGAGGTAAGCAGCGTCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


SPLK-Sequence tag 3SH004B04
Sequence
TGAGGTGTAGCTGNNNGCTGGCACCTGCGCCATCGCTGCCTCCCTGGTGCTACTTCTCTTTTGTCCCAGATGAGACATAT
TTTCTCCTGGATTTTCTTTTATATAGTGCTTTCTGGATTCTTTTATATAGTGCTTTCTGGATTCTTTTATATAGTGCTTT
CTGGATTCTTTTATATAGTGCTTTCTGGATTCTTTTATATAGTGCTTTCTGGATTCTTTTATATAGTGCTTTCTGGATTT
TTTTTTATATAGTGCTTTCTGGATTCTTTTATATAGTGCTTTCTGGATTCTTTTATATAGTGCTTTCTGGATTTTTTTTT
TTATATAGGGCTTTCTGGATTTTCTTTTATATGGGGCTTTCTGGA
Sequence Type genomic DNA
Unitrap ID UNI2422

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 56893020..56893387 344
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024590 (Lmnb1) NM_010721 lamin B1 Gene [Source:MGI (curated);Acc:Lmnb1-001]

 
Come back to gene ENSMUSG00000024590


For any suggestions or comments, please send an email to unitrap@crg.es