Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone LST012
Clone ID LST012
Vector pGT2TMpfs
Project baygenomics

Sequence tag LST012
Sequence
CCGGTCAGCGCCGGCCATCTTGTGGGAGCGAAACCAACGCCTGGCTGGGAGCAGCCGCCGCGGAG
Sequence Type mRNA
Unitrap ID UNI10213

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 59041675..59041735 58
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000048076 (Arf1) NM_007476 ADP-ribosylation factor 1 Gene [Source:MGI (curated);Acc:Arf1-001]

 
Come back to gene ENSMUSG00000048076


For any suggestions or comments, please send an email to unitrap@crg.es