Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H003G06
Clone ID H003G06
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH003G06
Sequence
TCTCTGCATGACGTGAAATAGAACTTTTTAGTTTTAGTTTTCTTAAGTATAGATGCTTCTTTTACTTAGGTCCATAGTTT
CTGTATTCCAAAAAAAGTTATGTCAAACAAAATTCATTATGCTAACCACTTAATGACATTTTTTTCATAAACTTGGTGAA
AAAGATTGCTTGTG
Sequence Type genomic DNA
Unitrap ID UNI2225

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 93959172..93959345 174
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042167 (Papd4) NM_133905 PAP associated domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:2140950]


SPLK-Sequence tag 3SH003G06
Sequence
TCTTAACCCTCCCTTCCCTCTGAGCTNNNTAATTCCGAATGCAGNGCNNNTACTGGGAACCCACTAACAACCAGCTGTCC
CCCAGCCTCCGTAGCAGGAAGTGTAGACTTGGGGGAGGAAGTGGAGAGACTTATTTCCTATGGGAAATACTTTGTACAAA
TTAGAGTTAGGCATTTGGAGCGAGGTTTTTTTTTTCAGAATTGAAAAACCAAGGAACA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000042167


For any suggestions or comments, please send an email to unitrap@crg.es