Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone H003F03
Clone ID H003F03
Vector FlipROSAbgeo0
Project ggtc

SPLK-Sequence tag 5SH003F03
Sequence
TGGCTTTCTCTTTTCATTAGGTGGTACATAATGTTCTATGTTCTCACATATAAATTCACCACTGTTAATTAATTGTG
Sequence Type genomic DNA
Unitrap ID UNI15257

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 52181201..52181277 77
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020402 (Vdac1) NM_011694 voltage-dependent anion channel 1 Gene [Source:MGI (curated);Acc:Vdac1-001]

 
Come back to gene ENSMUSG00000020402


For any suggestions or comments, please send an email to unitrap@crg.es